• <table id="4yyaw"><kbd id="4yyaw"></kbd></table>
  • <td id="4yyaw"></td>
  • 發布時間:2019-04-23 16:32 原文鏈接: CompetitiveRTPCRStrategyforQuantitativeEvaluation1

    Competitive RT-PCR Strategy for Quantitative Evaluation of the Expression of Tilapia (Oreochromis niloticus) Growth Hormone Receptor Type I

    Quantization of gene expression requires that an accurate measurement of a specific transcript is made. In this paper, a quantitative reverse transcription-polymerase chain reaction (RT-PCR) by competition for tilapia growth hormone receptor type I is designed and validated. This experimental procedure was used to determine the abundance of growth hormone receptor type I transcript in different tilapia tissues. The results obtained with this developed competitive RT-PCR were similar to real-time PCR results reported recently. This protocol provides a reliable alternative, but less expensive than real-time PCR to quantify specific genes.

    Key Words: Tilapia - Receptors - Somatostatin


    Introduction

    Growth hormone (GH) plays a central role as a pluripotent endocrine regulator of physiological functions in fish and higher vertebrates, working through specific cell membrane receptor (GHR) that triggers a phosphorylation cascade for signaling and gene expression events (1, 2). The nucleotide sequence of GHR is available for mammals, birds, reptiles, and Xenopus. Based on conserved structural features, these receptors belong to class I cytokine receptor superfamily that include, among others, receptors for prolactin, erythropoietin, granulocyte colony stimulating factor, and several interleukins (3). Since the initial cloning and sequence of goldfish (Carassius auratus) (4) and turbot (Scophthalmus maximus) (5) GHRs, other fish GHRs have been characterized in black sea bream (Acanthopagrus schlegeli) (6), gilthead sea bream (Sparus aurata) (7), masu salmon (Oncorhynchus masou) (8), rainbow trout (Oncorhynchus mykiss) (9), catfish (Silurus meridionalis), and tilapia (Oreochromis niloticus) (10). Amino acid alignment of full-length GHRs reveals a relative high degree of identity (35–40%) among tetrapods and non-salmonid fish GHRs (GHR type I). Several authors have postulated a divergent evolution of salmonid GHRs (GHR type II); however, it has recently been cloned a GHR in rainbow trout (Oncorhynchus mykiss), which is analogous to GHRs of non-salmonid fish (GHR type I) and a GHR type II in non-salmonid fish (11). Duplicated fish GHRs represent a new and perhaps complex step on the regulation of fish somatotropic axis. In this scenario, accurate measurements of both GHR expression patterns in different tissues and in different physiological stages are necessary. The classic methods to do this, such as Northern blots and RNAse protection assay, have been improved over the years and have provided reliable results. However, they share the weakness of having too low sensitivity among other drawbacks. Because of its extreme sensitivity, the polymerase chain reaction (PCR) has the potential to detect and precisely quantify specific RNA sequences if it is used in combination with reverse transcription. However, the repetitive multiplication of template molecules is a drawback for quantitative measurements because small differences in the multiplication factor lead to large differences in the amount of product (12). Although the use of PCR for quantification has been uncritically accepted by many scientists, it really cannot be relied upon for quantitative measurements. Two methods can be used to solve the problem of quantification: kinetic methods and co-amplification methods. Co-amplification methods can be done without expensive equipment. In this study, we design a competitor molecule to quantify accurately the tilapia growth hormone receptor type I (tiGHR I) in different tilapia tissues using a quantitative RT-PCR by competition and we show that it is sensitive, reproducible, and robust.


    Materials and Methods

    Cloning a TiGHR I Probe

    We designed four forward degenerate oligonucleotides (A, B, C, and D) that contained all the coding sequences for a conserved N glycosilation site of the GHR extracellular domain (LNWTLLNI) and four reverse degenerate oligonucleotides (E, F, G, and H) that contained all the coding sequences corresponding to the proline-rich site in the intracellular domain box I (PKIKGIDP) (Table 1).

    Table 1 Forward and reverse degenerate oligonucleotides to clone tiGHR I probe

    Oligonucleotides

    Sequences

    A

    5′…(tc)t(ag)aa(ct)tggac(acgt)(tc)t(ag)tt(ag)aa(ct)at…3′

    B

    5′…ct(tc)aa(ct)tggac(acgt)tt(ag)(ct)t(ag)aa(ct)at…3′

    C

    5′…(ct)t(ag)aa(ct)tggac(acgt)ct(tc)ct(tcag)aa(tc)at…3′

    D

    5′…ct(tc)aa(ct)tggac(acgt)ct(tcag)ct(tc)aa(tc)at…3′

    E

    5′…gg(ga)tc(tag)at(tg)cc(tc)tt(tga)at(tc)tt(tg)gg…3′

    F

    5′…gg(ga)tc(tga)at(tg)cc(tc)tt(tga)at(tc)tt(ca)gg…3′

    G

    5′…gg(ga)tc(tag)at(ca)cc(tc)tt(tga)at(tc)tt(tg)gg…3′

    H

    5′…gg(ag)tc(tag)at(ca)cc(tc)tt(tga)at(tc)tt(ca)gg…3′

    Total RNA from tilapia liver (O. niloticus) was obtained by the acid phenol method (13). Messenger RNA was purified from total RNA using the “PolyAtract? mRNA Isolation System III” kit (Promega, USA). Messenger RNA was reverse transcribed with oligo (dT) 15 using “Reverse Transcription System” (Promega). Polymerase chain reactions were set up in 50-μl volumes using “PCR Master Mix” (Promega) with 3 μM of forward and reverse primers and 1/10 volume of the RT reaction. We used all possible combinations of the degenerated oligonucleotides (16 different reactions). The PCR condition used 95°C for 3 min, followed by a cycling program of 94°C for 1 min, 42°C for 1 min and 72°C for 1 min for 30 cycles, and a final extension at 72°C for 5 min. PCR products were purified from agarose gel using “Qiaquick? Gel Extraction” Kit (Qiagen, USA) and cloned in T-vector (pGEM?-T Easy Vector System I, Promega).The selected clones were sequenced using standard techniques (14).

    Generation of Competitor

    Starting with a clone containing an insert of 458 bp of tiGHR I (Probe), we did two subcloning steps to obtain an internal duplication of 100 bp respect to original fragment, generating a fragment used as competitor (Fig. 1). The competitor was linearized with the endonuclease Sma I and transcribed in vitro using “T7 RiboMAX Express RNAi System” kit (Promega) to obtain the competitor RNA.

    MediaObjects/12575_2009_9002_Fig1_HTML.gif

    Fig. 1 Design for the isolation of probe from the tiGHR I cDNA and construction of competitor fragment to use in quantitative PCR. a Diagram of probe amplification from the tiGHR I cDNA using degenerate oligonucleotide B and E. ECD, extracellular domain; TMD, transmembrane domain; ICD, intracellular domain; black box 1, conserved N glycosilation site of the GHR extracellular domain (LNWTLLNI); black box 2, coding sequences corresponding to the proline-rich site in the intracellular domain box I (PKIKGIDP); Probe, 458-bp DNA fragment of tiGHR I obtained with the B–E oligonucleotide mixes and cloned in Easy T-vector (shadow boxes); Competitor, 473 DNA fragment obtained from two subcloning steps to produce a tandem of two copies of the Pst I–Acc I fragment of the Probe; I and J, internal oligonucleotide from the probe fragment designed for the amplification of target and competitor; E, EcoR I; P, Pst I; A, Acc I; S, Sac I. b 2% agarose gel image with the PCR amplification products using oligonucleotides I and J: 1, PCR negative control (without template); 2, PCR using a RT reaction from tilapia liver mRNA as template;3, PCR using competitor sequence as template, 4, PCR using probe as template.


    Competitive PCR

    We designed two specific oligonucleotides (I?=?ccccacctactgctgatgttag and J?=?caggaacaggcggcagcagg) that hybridize inside to the fragment of the tiGHR gene cloned between binding sites of degenerate oligonucleotides. When we use these specific oligonucleotides in a PCR, we generate a 366 bp amplification product from the wild-type DNA (T-target) and a 473 bp amplification product from the competitor DNA (Ccompetitor) (Fig. 1 b). The PCR reactions were set up in 50 μl with “PCR Master Mix” and 0.2 μM of each primer. We used a denaturalization step of 95°C for 2 min, followed by a cycling program of 94°C for 30 s, 62°C for 30 s, and 72°C for 1 min for 30 cycles. A PCR negative control was set up for all the PCR batches to ascertain the authenticity of PCR. The amplification products were resolved in 2% agarose gels with ethidium bromide. Gel images were obtained using a digital camera Olympus C7070 Wide Zoom. The photos saved in jpeg format were used for densitometry analysis.

    Quantitative Analysis

    The densitometry data for band intensities in different sets of experiments was generated by analyzing the gel images on the Image J program (Version 1.33, USA). Previously to the experiments of competitive PCR, we did an experiment (data not shown) to control the consistency of our densitometry raw data. Because of the low dynamic range of ethidium bromide gels, it is necessary to control if the peak areas corresponding to densitometry values obtained by Image J program reproduce really the band intensities. In this experiment, we used a wide range of concentration of DNA and considered the relation dose–response. The lineal relation is lost after 100 ng of DNA.

    Determination of Target/competitor Amplification Efficiency

    Ten identical PCR mixtures were prepared, as described above, each containing 100,000 molecules of target and competitor DNA. The PCR cycling conditions were carried through 45 cycles with one tube being removed after 17, 19, 21, 24, 27, 30, 33, 36, 39, and 45 cycles and the amount of the PCR products quantified. Procedure was repeated two times. Efficiency was calculated as $${\text{Ei}} = {{\left( {{\text{Pi}} - {\text{Pi}} - 1} \right)} \mathord{\left/ {\vphantom {{\left( {{\text{Pi}} - {\text{Pi}} - 1} \right)} {{\text{Pi}} - 1}}} \right. \kern-\nulldelimiterspace} {{\text{Pi}} - 1}}$$(12), where Ei is the efficiency in one step, Pi is the quantity of product in that step, and Pi???1 is the product already accumulated during the previous step. The efficiency means for target and competitor in each cycle were compared using matched t test.


  • <table id="4yyaw"><kbd id="4yyaw"></kbd></table>
  • <td id="4yyaw"></td>
  • 调性视频